View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3930_low_7 (Length: 207)
Name: NF3930_low_7
Description: NF3930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3930_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 56 - 207
Target Start/End: Complemental strand, 24598904 - 24598753
Alignment:
| Q |
56 |
ctatgttacaaacattgaatcagttcaaaatcacaaattcaaccaacaaaatttagatcatgttaccgttttaacatcctcaaaagtgtcctcatattga |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24598904 |
ctatgttacaaacattgaatcagttcaaaatcacaaattcaaccaacaaaatttagatcattttaccgttttaacatcctcaaaagtgtcctcatattga |
24598805 |
T |
 |
| Q |
156 |
ccaccaagctcactaacaatggtaactcttctatcttcactcctttgcttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24598804 |
ccaccaagctcactaacaatggtaactctcctatcttcactcctttgcttct |
24598753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University