View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3931_high_18 (Length: 270)
Name: NF3931_high_18
Description: NF3931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3931_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 3 - 197
Target Start/End: Original strand, 30022499 - 30022692
Alignment:
| Q |
3 |
taaaagacatgatcttaattggagtctaggggagagattctgcgcactctgttaacttgttatatttattaaccattcacaaaattatgttattcacata |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
30022499 |
taaaagacatgatcttaattggagtctaggggagagattctgcacactctgttaacttgttatattcattaaccattcacaaa-ttatgttattcacata |
30022597 |
T |
|
| Q |
103 |
tttgaactgctttaataatacaataatcttttgtcaaatttgatatcaaatttttgtatcaaattaaataaatactatttctattattaactccg |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
30022598 |
tttgaactgctttaacaatacaataatcttttgtcaaatttgatatcaaatttttgtatcaaattaaataagtactatttctcttattaactccg |
30022692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University