View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3931_low_18 (Length: 272)

Name: NF3931_low_18
Description: NF3931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3931_low_18
NF3931_low_18
[»] chr5 (1 HSPs)
chr5 (194-263)||(14122529-14122598)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 194 - 263
Target Start/End: Complemental strand, 14122598 - 14122529
Alignment:
194 gagtgatgtatcaaatgctaataaagcacaagaaggttcatcttcttttccctatacttgtgagaataat 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
14122598 gagtgatgtatcaaatgctaataaagcacaagaaggttcatcttcttttcactatacttgtgaaaataat 14122529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University