View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3931_low_22 (Length: 250)
Name: NF3931_low_22
Description: NF3931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3931_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 1476860 - 1477099
Alignment:
| Q |
1 |
agattctctagtccatgcagtcaatctaaccataagttaacgaccaaccttcagttagacctacttcgtgtaagataattctaagtcccacaaacaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1476860 |
agattctctagtccatgcagtcaatctaaccataagtcaacgaccaaccttcggttagacctacttcgtgtaagataattctaagtcccacaaacacaaa |
1476959 |
T |
|
| Q |
101 |
tctcaatattttagaatggaaaaaggaagagcaacatacctgaattcgtcccacttataccaatggaattcgtatggagtttgaaccgtgaatccacttg |
200 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1476960 |
tttcaatattttagaatggaaaagggaagagcaacatacctgaattcgtcccacttataccaatggaattcgtatggagtttgaattgtgaatccacttg |
1477059 |
T |
|
| Q |
201 |
agaaccaatttgttaaattctcacttaccaaaaccctttg |
240 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1477060 |
agtaccaatttgttaaattctcacttaccaaaaccctttg |
1477099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University