View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3932_high_1 (Length: 251)
Name: NF3932_high_1
Description: NF3932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3932_high_1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 4133483 - 4133715
Alignment:
| Q |
19 |
attgtggcggcatagacaattattcagagcttttgatgttattgttgatttaagtatggttaccaaaaatcgagttattttttatacagggccatttcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4133483 |
attgtggcggcatagacaattattcagagcttttgttgttattgttgatttaagtatggttactaaaaattgagttattttttatacagggccatttcta |
4133582 |
T |
|
| Q |
119 |
attttattaccaaataaaataaagatgagggaatgaggagcaagtaatgtagctacctacctggatggtaacttcatcttcttcggcttcagacaggaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133583 |
attttattaccaaataaaataaagatgagggaatgaggagcaagtaatgtagctacctacctggatggtaacttcatcttcttcggcttcagacaggaag |
4133682 |
T |
|
| Q |
219 |
catctccacctcattcaccggttgaggtgccac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4133683 |
catctccacctcattcaccggttgaggtgccac |
4133715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University