View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_high_19 (Length: 296)
Name: NF3934_high_19
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 44 - 287
Target Start/End: Original strand, 36755501 - 36755745
Alignment:
| Q |
44 |
ggacgaatcgtttgattatatctaaaatatttgttttctttcgtctagnnnnnnnn-gaacaagccatttctttcgtctagttgttttattgaatnnnnn |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36755501 |
ggacgaatcgtttgattatatctaaaatatttgttttctttcgtctagtttttttttgaacaagccatttctttcgtctagttgttttattgaataaaaa |
36755600 |
T |
 |
| Q |
143 |
nntgcttcaagttggagaacagaaacaaatacttccgtttatttttaaatgtcggnnnnnnnaacattttaacacataaattcattacttttgataccat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36755601 |
aatgcttcaagttggagaacagaaacaaatacttccgtttatttttaaatgtcggtttttttaacattttaacacataaattcattacttttgataccat |
36755700 |
T |
 |
| Q |
243 |
tctatctatgttttttacaatacattaattatttattatctcatt |
287 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36755701 |
tttatctatgttttttacaatacattaattatttattatctcatt |
36755745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University