View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_high_25 (Length: 267)
Name: NF3934_high_25
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 248
Target Start/End: Original strand, 35020176 - 35020402
Alignment:
| Q |
22 |
atcttagtggttcatttgttgtttctgacacgttaccgtatttgagatggttggatttggatggaaaacagaagcaaatgaagaaaacagcaaaagaaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35020176 |
atcttagtggttcatttgttgtttctgacatgttaccgtatttgagatggttggatttggatggaaaacagaagcaaatgaagaaaacagcaaaagagtt |
35020275 |
T |
 |
| Q |
122 |
ggatgagtttgtttgtgtttggcttgatcaacacaaacgtaacaagaattctggtcgtgaacaagatttcatggatgtgctgctttcaaccgttgatgaa |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35020276 |
agatgactttgtttgtgtttggcttgatcagcacaaacataagaagaattctggtcgtgaacaagatttcatggatgtgctgctttcaaccgttgatgaa |
35020375 |
T |
 |
| Q |
222 |
gatttagatggtcgtgatgctgatact |
248 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
35020376 |
gatttagatggccgtgatgctgatact |
35020402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 21 - 244
Target Start/End: Original strand, 35036374 - 35036603
Alignment:
| Q |
21 |
gatcttagtggttcatttgttgtttctgacacgttaccgtatttgagatggttggatttggatggaaaacagaagcaaatgaagaaaacagcaaaagaaa |
120 |
Q |
| |
|
||||| || |||||||||||| | ||||||| ||| | || ||| |||||||||||||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
35036374 |
gatctcagcggttcatttgttatatctgacatgttgcggttttttagatggttggatttggatggaaaacagaagcagatgaagaaaacggctaaagagt |
35036473 |
T |
 |
| Q |
121 |
tggatgagtttgtttgtgtttggcttgatcaacacaaacgtaacaagaattctggtcgtgaacaa----gatttcatggatgtgctgctttcaaccgttg |
216 |
Q |
| |
|
| ||||| |||||| |||||||| |||||||||||||| |||||||| || | || | ||| || |||||||||||||| ||||||||||||| |
|
|
| T |
35036474 |
tagatgattttgttcaagtttggctcgatcaacacaaacgcaacaagaaacct-gccggcaccaaacttgacttcatggatgtgctcctttcaaccgttg |
35036572 |
T |
 |
| Q |
217 |
atg---aagatttagatggtcgtgatgctga |
244 |
Q |
| |
|
||| ||||| ||||||||||||||||||| |
|
|
| T |
35036573 |
atgatcaagatatagatggtcgtgatgctga |
35036603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 22 - 162
Target Start/End: Original strand, 35044506 - 35044646
Alignment:
| Q |
22 |
atcttagtggttcatttgttgtttctgacacgttaccgtatttgagatggttggatttggatggaaaacagaagcaaatgaagaaaacagcaaaagaaat |
121 |
Q |
| |
|
||||| ||||||| |||||| | ||||| |||| |||| ||| |||||||||||||||||||||||| ||||| ||||||||||||| || ||||| | |
|
|
| T |
35044506 |
atctttgtggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaagagaaggaaatgaagaaaactgctaaagagtt |
35044605 |
T |
 |
| Q |
122 |
ggatgagtttgtttgtgtttggcttgatcaacacaaacgta |
162 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
35044606 |
ggatgagtttgttcaaggttggattgatcaacacaaacgta |
35044646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 35030251 - 35030299
Alignment:
| Q |
191 |
catggatgtgctgctttcaaccgttgatgaagatttagatggtcgtgat |
239 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
35030251 |
catggatgtgctgctttccaccattgatgaagatttagatgttcgtgat |
35030299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University