View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_high_27 (Length: 261)
Name: NF3934_high_27
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 42224268 - 42224023
Alignment:
| Q |
11 |
attagttacaatatgcaattgtagccaagtatttaaaagtaaaatcaccagtcccatacagcctgaggaaattgatgccacaacatttgaaatatggaat |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224268 |
attagttacaatatgcaattgcagccaagtatttaaaagtaaaatcaccagtcccatacagcctgaggaaattgatgccacaacatttgaaatatggaat |
42224169 |
T |
 |
| Q |
111 |
gaactttgcatttggtggtactggtgtgtttgatacgttgaatccaggcccaaacatgacaacccagatcaattttttccaacaagtcataaaagacaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224168 |
gaactttgcatttggtggtactggtgtgtttgatacgttgaatccaggcccaaacatgacaacccagatcaattttttccaacaagtcataaaagacaaa |
42224069 |
T |
 |
| Q |
211 |
gtgtacacagcctcagacatcaataattcagttgctcttgtctctg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224068 |
gtgtacacagcctcagacatcaataattcagttgctcttgtctctg |
42224023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 95 - 146
Target Start/End: Original strand, 26335935 - 26335986
Alignment:
| Q |
95 |
atttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatac |
146 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
26335935 |
atttgaagtatgggatgaactttgcatatggtggtacaggtgtatttgatac |
26335986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 95 - 176
Target Start/End: Original strand, 26322918 - 26322999
Alignment:
| Q |
95 |
atttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatacgttgaatccaggcccaaacatgacaaccca |
176 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||| || ||||| |||||||| || | | |||| ||||| |||||| |||| |
|
|
| T |
26322918 |
atttgaagtatgggatgaactttgcatatggtggcacaggtgtatttgatacatttacttcaggaccaaatatgacagccca |
26322999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University