View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_high_33 (Length: 243)
Name: NF3934_high_33
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 55 - 233
Target Start/End: Original strand, 2577603 - 2577781
Alignment:
| Q |
55 |
ctgagtttaaacatgatgatgaaatatgaacaggggatgttctgcttcactgcgtggttgatgcaattttaggggctttaggtcttcctgatataggaca |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2577603 |
ctgagtttaaacatgatgatgaaatatgaacaggggatgttctgcttcactgcgtggttgatgcaattttaggggctttaggtctccctgatataggaca |
2577702 |
T |
 |
| Q |
155 |
gatttttcctgattctgatcctaagtggaagggttgcgattcttcggtgtttgtccatgaatctgtgagtattatctac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2577703 |
gatttttcctgattctgatcctaagtggaagggttgcgattcttcggtgtttgtccatgaatctgtgagtaatatctac |
2577781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University