View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_high_34 (Length: 240)
Name: NF3934_high_34
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 42224361 - 42224586
Alignment:
| Q |
1 |
aataggtttaatttgtattgtttttaatcacatccaatgacactttcaacaatatgcaacaattatttatttgttacaa---gggaggactttaggtcaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
42224361 |
aataggtttaatttgtattgtttttaatcacatccaatgacactttcaacaatatgcaacaattatttgtttgttacaataagggaggactttaggtcaa |
42224460 |
T |
 |
| Q |
98 |
actagaatgaagcacgacgattaaagtaaacacaaagttgagcaagacctgtaagtaaatgggaaaaatataaaagagtcctctaattaattttctagta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42224461 |
actagaatgaagcacgacgattaaagtaaacacaaagttgagcaagacctgtaagtaaatgggaaaaatataaaagagtcctctaattaa-tttctagta |
42224559 |
T |
 |
| Q |
198 |
cttgagcaacatgattaaagttggaca |
224 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
42224560 |
cttgagcaacatgattcaagttggaca |
42224586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University