View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_high_35 (Length: 240)
Name: NF3934_high_35
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 27527815 - 27528022
Alignment:
| Q |
17 |
aaattacttatcttactttattttaaagccttccaaaacaacatttttccacgaactcgtacatatgaaatgaagacaacatactacaatttcagatgac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||| | ||||| | |
|
|
| T |
27527815 |
aaattacttatcttactttattttaaagcctttcaaaacaacatttttccatgaactcgtacatatgaaatgaagacaacacactacagta--agatgcc |
27527912 |
T |
 |
| Q |
117 |
tttgttgaaatgattattgagaaacaaatgggaagaaaatattcttaatcttcttatcttggtcaaaactgtcatcaatcacatatcattccttccaata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27527913 |
tttgttgaaatgattattgagaaacaaatgggaagaaaatattctcaatcttcttatcttggtcaaaactgtcatcaatcacatatcattccttccaata |
27528012 |
T |
 |
| Q |
217 |
tcattacatt |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
27528013 |
tcattacatt |
27528022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University