View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_low_30 (Length: 254)
Name: NF3934_low_30
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 36523046 - 36522801
Alignment:
| Q |
1 |
aggactaaccaatggatctaacttttgtggtcccaacaacactgatctacataacctctcaactttgtctctttccttattgcttttcattgattccttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36523046 |
aggactaaccaatggatctaacttttgtggtcccaacaacactgatctacataacctctcaactttgtctctttccttattgcttttcattgattccttc |
36522947 |
T |
 |
| Q |
101 |
ttgatccttgaaggagttaaatcattgatttcccaaagtgtagcagcaagttttctagcagacacagaaatttctttcttctctttgaagggtaatccag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522946 |
ttgatccttgaaggagttaaatcattgatttcccaaagtgtagcagcaagttttctagcagacacagaaatttctttcttctctttgaagggtaatccag |
36522847 |
T |
 |
| Q |
201 |
tacgtgaagaatgcaaagctgtgtttttcatagcatgatgatgatg |
246 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36522846 |
tacgtgaagaatgcaaagctgtctttttcatagcatggtgatgatg |
36522801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 93 - 170
Target Start/End: Original strand, 18972960 - 18973037
Alignment:
| Q |
93 |
attccttcttgatccttgaaggagttaaatcattgatttcccaaagtgtagcagcaagttttctagcagacacagaaa |
170 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| | | |||||||||||||||||| || ||||||| |
|
|
| T |
18972960 |
attccttcttgacccttgaaggatgcaaatcattgatttcccacaaagaagcagcaagttttctagctgaaacagaaa |
18973037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University