View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_low_32 (Length: 247)
Name: NF3934_low_32
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_low_32 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 10803614 - 10803827
Alignment:
| Q |
18 |
tctatcccaatcatacaaaacaaaatccaaaagcacaaaatctatccaaccatcaagaaaccttgttgtgtgaatcaaatcaagtgtattgtcaaaaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10803614 |
tctatcccaatcatacaaaacaaaatccaaaagcacaaaatctatccaaccatcaagaaaccttgttgtgtgaatcaaatcaagtgtattgtcaaaaaat |
10803713 |
T |
 |
| Q |
118 |
ggaagcctttgatttatagtcaaataaagaggaacaagtcctctaagagctaccatttcactaaagggtgcaccaagattaatagttgctgaaactattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10803714 |
ggaagcctttgatttatagtcaaataaagaggaacaagtcctctaagagctaccatttcactaaagggtgcaccaagattaatagttgctgaaactattg |
10803813 |
T |
 |
| Q |
218 |
tcacattatattcc |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10803814 |
tcacattatattcc |
10803827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 133
Target Start/End: Original strand, 252828 - 252946
Alignment:
| Q |
15 |
aattctatcccaatcatacaaaacaaaatccaaaagcacaaaatctatccaaccatcaagaaaccttgttgtgtgaatcaaatcaagtgtattgtcaaaa |
114 |
Q |
| |
|
||||||||||||||||||||| | |||||||| | | | ||| ||||||||||| | ||||| ||||| ||||||||||| | | || ||||| |
|
|
| T |
252828 |
aattctatcccaatcatacaatatgaaatccaataatagcagatcaatccaaccatccataaacccagttgtatgaatcaaatccataatgttatcaaag |
252927 |
T |
 |
| Q |
115 |
aatggaagcctttgattta |
133 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
252928 |
aatggaagcctttgattta |
252946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University