View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_low_34 (Length: 246)
Name: NF3934_low_34
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 7 - 216
Target Start/End: Complemental strand, 12544304 - 12544091
Alignment:
| Q |
7 |
ggacatcatcattgaataatcaaattctaatttcactgtagc---tgtcaaatatagtaatagttcataca-cccatgcacgtgaagttttgcaattgta |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
12544304 |
ggacatcatgattgaataatcaaattctaatttcactgtagcaactgtcaaatatagtaataggtcatagaacccatgcacgtgaagttttgcaattgta |
12544205 |
T |
 |
| Q |
103 |
ggagcaacaatccaaaaattgttgaattcatggaacaacatattattctcatagtactttaaatactacacctccctctcactacaaaatacaaatgttg |
202 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12544204 |
ggagcaacagtccaaaaattgttgaattcatggaacaacatattattctcagagtactttaaatactacacctccctctcacgacaaaatacaaatgttg |
12544105 |
T |
 |
| Q |
203 |
ctaagttagtaagt |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12544104 |
ctaagttagtaagt |
12544091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University