View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3934_low_39 (Length: 230)
Name: NF3934_low_39
Description: NF3934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3934_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 11 - 107
Target Start/End: Complemental strand, 4403035 - 4402939
Alignment:
| Q |
11 |
aggtaaaggtgaacttgatgtagaagatgacgaaaaattatgaaaaggaaaatgcagctcatagaaaataacatttctagaaatgaataactgatga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4403035 |
aggtaaaggtgaacttgatgtagaagatgacgaagaaacatgaaaaggaaaatgcagctcatagaaaatattatttctagaaatgaataactgatga |
4402939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 6096591 - 6096454
Alignment:
| Q |
50 |
atgaaaaggaaaatgcagctcatagaaaataacatttctagaaatgaataactgatgagaaagtaactcatagagaatatatcctttgactccctctttg |
149 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| |||||||| | | ||||||||| | || ||||| | |||||| || || || |||||||| |
|
|
| T |
6096591 |
atgaaaaggaaaatgatcctcaaagaaaataacattcctagaaataatcatttgatgagaatgcaaatcatacaaaatatagccctttacaccctcttta |
6096492 |
T |
|
| Q |
150 |
taaccaagaaaaacagcctttctagccctatgatcaaa |
187 |
Q |
| |
|
|||||||||||||| | |||||||| |||||| |||| |
|
|
| T |
6096491 |
taaccaagaaaaactgtttttctagctctatgaccaaa |
6096454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University