View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3935_high_9 (Length: 277)
Name: NF3935_high_9
Description: NF3935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3935_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 17203483 - 17203327
Alignment:
| Q |
1 |
agagaacctttgttgatttgaggagagaagatggcgaatcgagggggaagtgtaatgtaaggaagaaggatga---cgatgatggtgttagttagggtcc |
97 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17203483 |
agagtacctttgttgatttgaggagagaagatggcgaatcgaggaggaagtgtaatgtaaggaagaaggatgatgacgatgatggtgttagttagggtcg |
17203384 |
T |
 |
| Q |
98 |
aagttaaacagtggtgtcaatgaatgaagtaaagttcaatgcatcattatttatacc |
154 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17203383 |
aagttgaacagtggtttcaatgaatgaagtaaagttcaatgcatcattatttatacc |
17203327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 256
Target Start/End: Complemental strand, 17203247 - 17203213
Alignment:
| Q |
222 |
gtcgcaagatatcttcaccacttgtatatatcttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17203247 |
gtcgcaagatatcttcaccacttgtatatatcttt |
17203213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University