View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3935_low_10 (Length: 277)

Name: NF3935_low_10
Description: NF3935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3935_low_10
NF3935_low_10
[»] chr4 (2 HSPs)
chr4 (1-154)||(17203327-17203483)
chr4 (222-256)||(17203213-17203247)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 17203483 - 17203327
Alignment:
1 agagaacctttgttgatttgaggagagaagatggcgaatcgagggggaagtgtaatgtaaggaagaaggatga---cgatgatggtgttagttagggtcc 97  Q
    |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||   |||||||||||||||||||||||     
17203483 agagtacctttgttgatttgaggagagaagatggcgaatcgaggaggaagtgtaatgtaaggaagaaggatgatgacgatgatggtgttagttagggtcg 17203384  T
98 aagttaaacagtggtgtcaatgaatgaagtaaagttcaatgcatcattatttatacc 154  Q
    ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||    
17203383 aagttgaacagtggtttcaatgaatgaagtaaagttcaatgcatcattatttatacc 17203327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 222 - 256
Target Start/End: Complemental strand, 17203247 - 17203213
Alignment:
222 gtcgcaagatatcttcaccacttgtatatatcttt 256  Q
    |||||||||||||||||||||||||||||||||||    
17203247 gtcgcaagatatcttcaccacttgtatatatcttt 17203213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University