View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3935_low_12 (Length: 272)
Name: NF3935_low_12
Description: NF3935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3935_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 257
Target Start/End: Original strand, 7659928 - 7660181
Alignment:
| Q |
4 |
ttactaattgaccacaaaagcgtaacagataattttcttaacaaacgttgtaaaatatattcacatcttagagaaaacaaatttacacaatcagaaaaga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7659928 |
ttactaattgaccacaaaagcgtaacagataattttcttaacaaacgttgtaaaatatattcacatcttagagaaaacaaatttacacaatcagaaaaga |
7660027 |
T |
|
| Q |
104 |
attaaaggaacacctatcataatcccaaacacatttttgtcttggatttagtcacatgaaaattcaaacacataaaccagnnnnnnnnnnnncaatcacc |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7660028 |
attaaaagaacacctatcataatcccaaacacatttttgtcttggatttagtcacatgaaaattcaaacacataaaccagaaaaaataaaaacaatcacc |
7660127 |
T |
|
| Q |
204 |
acccttgaattggccaacgattgtttggatctggaagccaagaagaacgtttct |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7660128 |
acccttgaattggccaacgattgtttggatctggaagccaagaagaacgtttct |
7660181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 199 - 257
Target Start/End: Original strand, 7662721 - 7662779
Alignment:
| Q |
199 |
tcaccacccttgaattggccaacgattgtttggatctggaagccaagaagaacgtttct |
257 |
Q |
| |
|
|||||||||||||| ||||||||| || | |||||||||||||||||| |||||||||| |
|
|
| T |
7662721 |
tcaccacccttgaactggccaacgtttttgtggatctggaagccaagacgaacgtttct |
7662779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University