View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3935_low_14 (Length: 262)
Name: NF3935_low_14
Description: NF3935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3935_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 6667896 - 6668116
Alignment:
| Q |
21 |
agagcagcataaacgaaccagtaaaaaacccaacaaggaaaagagttctatcgtcattccaaagcttcactatgctttcaggtttctctttttacacatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667896 |
agagcagcataaacgaaccagtaaaaaacccaacaaggaaaagagttctatcgtcattccaaagcttcactatgctttcaggtttctctttttacacatt |
6667995 |
T |
 |
| Q |
121 |
tcgtttactctttcacgtttcttcatttcatatttgaattcctctatttgtgatttaggttaacatattgaaaaacgaaacgaatatatggtgattgata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667996 |
tcgtttactctttcacgtttcttcatttcatatttgaattcctctatttgtgatttaggttagcatattgaaaaacgaaacgaatatatggtgattgata |
6668095 |
T |
 |
| Q |
221 |
tttagatcatcacaggggaga |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6668096 |
tttagatcatcacaggggaga |
6668116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University