View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3935_low_4 (Length: 381)
Name: NF3935_low_4
Description: NF3935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3935_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 106 - 363
Target Start/End: Complemental strand, 50787878 - 50787619
Alignment:
| Q |
106 |
ataacatggcattggtacgaaaatcatgaccaatcttccctaaggaagacgtcttagcatgtttaatgtggtctaggctcctatannnnnnnnnncattc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
50787878 |
ataacatggcattggtacgaaaatcatgaccaatcttccctaaggaagacgtcttatcatgtttaatgtggtctaggctcccatattttttttt-cattc |
50787780 |
T |
|
| Q |
206 |
ataaaatttgaacctaaaacctcattcatatggtt---ttcaattccgctcggtccaacataattttagtggttttgttatatgtttgaaggtagaatga |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50787779 |
ataaaatttgaacctaaaacctcattcatatggttaaattcaattccactcgatccaacataattttagtggttttgttatatgtttgaaggtagaatga |
50787680 |
T |
|
| Q |
303 |
gcattcaattcaatcaaatttttatgcaatcactagcagtaagatttgtgattgtctaact |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50787679 |
gcattcaattcaatcaaatttttatgcaatcactgatagtaagatttgtgattgtctaact |
50787619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University