View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3936_high_12 (Length: 300)
Name: NF3936_high_12
Description: NF3936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3936_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 7631367 - 7631653
Alignment:
| Q |
1 |
attactttgcttttgagttctatgataaaaaccgttaaaccagagttcttatataatgtatgaaatttgatccatctctgaatgtacatccaatggatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7631367 |
attactttgcttttgagttctatgataaaaaccgttaaatcatagttcttatataatgtatgaaatttgatccatctctgaatgtacacccaatggatta |
7631466 |
T |
|
| Q |
101 |
tttgatccatattgatgcaatgcggccagatgaagactggcgcctactaaaacaaaggggagtaccctctattgttttcgttaccaagata--tgtannn |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||| | | |
|
|
| T |
7631467 |
tttgatccatattgatgcaatgcggccagatgaagattggcgcctactaaaacaaaggggagtaccctctattgttttcgttatcgagatattttttttt |
7631566 |
T |
|
| Q |
199 |
nnnncattgttcccagggattttttgggtaatccgttcccatgctgcaaacagtcaaatctaaactaagccttgtcgctcttctttc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7631567 |
ttttcattgttcccagggattttttgggtaatctgttcccatgctgcaaacagtcaaatctaaactaaaccttgtcgctcttctttc |
7631653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 203 - 243
Target Start/End: Original strand, 2112091 - 2112131
Alignment:
| Q |
203 |
cattgttcccagggattttttgggtaatccgttcccatgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2112091 |
cattgttcccagggattttttgggtaatccgctcccatgct |
2112131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University