View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3936_high_13 (Length: 285)
Name: NF3936_high_13
Description: NF3936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3936_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 121 - 280
Target Start/End: Original strand, 43317994 - 43318153
Alignment:
| Q |
121 |
taatacttgtaaggcgtgtgagtagtatttttcatggtgttggtagcaatacttaatttgttggggtgttggtattgaattgcgtgggtgcatatagtaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43317994 |
taatacttgtaaggcgtgtgagtagtatttttcatggtgttggtagcaatacttaatttgttggggtgttggtattgaattgcgtgggtgcatatagtaa |
43318093 |
T |
|
| Q |
221 |
taccgaatgttcagctcgcccattcttcactgtattctattctatcgatcctttgcttct |
280 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43318094 |
taccgaatgttcagctcgcgcattcttcactgtattctattctatcgatccttttcttct |
43318153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 43317829 - 43317919
Alignment:
| Q |
1 |
gtcataagagtttacatctaatcacttccacttatcactttgtcaatgatgtttacaatattgtcaatgtcatatttgatgttctgaaata |
91 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
43317829 |
gtcataagagtttatatctaatcacttccacttatcactttgtcaatgatgtttacaatattgtcaatgtcatattcgacgttctgaaata |
43317919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University