View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3936_high_15 (Length: 256)
Name: NF3936_high_15
Description: NF3936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3936_high_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 101 - 256
Target Start/End: Original strand, 43317692 - 43317847
Alignment:
| Q |
101 |
cttttcaaacaatgctgtagtttacaaactgtaattgagttctgaaataaactttcatagcacaattacttatagtctaaaaaataagtttcaaaatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43317692 |
cttttcaaacaatgctgtagtttacaaactgtaattgagttctgaaataaactttcatagcacaattacttatagtctataaaataagtttcaaaatgtt |
43317791 |
T |
 |
| Q |
201 |
ctaaatacctaccaaaattgtccgagttgcttgctcagtcataagagtttacatct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43317792 |
ctaaatacctaccaaaattgtccgagttgcttgctcagtcataagagtttatatct |
43317847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University