View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3936_low_14 (Length: 260)
Name: NF3936_low_14
Description: NF3936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3936_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 90 - 248
Target Start/End: Complemental strand, 33658491 - 33658333
Alignment:
| Q |
90 |
agatctaacaagaatctcaaataagatacacaaatttttgaagtataacttgtttgaagaaatttgatatgagactatctatttgtatacttattattag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33658491 |
agatctaacaagaatctcaaataagatacacaaatttttgaagtataacttgtttgaagaaatttgacatgagactatctatttgtatacttattattag |
33658392 |
T |
 |
| Q |
190 |
agtggttggcactgacaaatgtcacactgaaagcaacaagtgtgtgattattctctgct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33658391 |
agtggttggcactgacaaatgtcacactgaaagcaacaagtgtgtgattattctttgct |
33658333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University