View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3936_low_16 (Length: 250)

Name: NF3936_low_16
Description: NF3936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3936_low_16
NF3936_low_16
[»] chr4 (1 HSPs)
chr4 (10-250)||(40077648-40077888)


Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 40077648 - 40077888
Alignment:
10 gcagagaaagtaagtgaacgttatggtgagatgagggaagagtatgttaagaatttaggtgacatgagaagaccttttattacacattttacagggtgcc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40077648 gcagagaaagtaagtgaacgttatggtgagatgagggaagagtatgttaagaatttaggtgacatgagaagaccttttattacacattttacagggtgcc 40077747  T
110 aaccttgtaatggtcaccataatccaatgtatgctgcagatgattgctggaatggcatggagagagctctcaattttgctgataatcaggtgttgcgcaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40077748 aaccttgtaatggtcaccataatccaatgtatgctgcagatgattgctggaatggcatggagagagctctcaattttgctgataatcaggtgttgcgcaa 40077847  T
210 gtttggcttcattcatccaaatctattggataagtctgttt 250  Q
    |||||||||||||||||||||||||||||||||||||||||    
40077848 gtttggcttcattcatccaaatctattggataagtctgttt 40077888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University