View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3936_low_7 (Length: 333)
Name: NF3936_low_7
Description: NF3936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3936_low_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 41516660 - 41516326
Alignment:
| Q |
1 |
tacttgagaataaagagcttcaagggtttcttgggtggcagtttgaagaggaccaacatatatacaagatggaccatgaggacggtcgtcgcaggtggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41516660 |
tacttgagaataaagagcttcaagggtttcttgggtggcagtttgaagaggaccaacatatatacaagatggaccatgaggacggtcgtcgcaggtggca |
41516561 |
T |
|
| Q |
101 |
gagatccgaagagaaaaggaagatgaaacagaacggttgtttctgattttggatacttgtaacaccgtccatccacctaaagcggtgccgctgttgcttg |
200 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41516560 |
cagatacgaagagagaaggaagatgaaacagaacggttgtttctgattttggatacttgtaacaccgtccatccacctaaagcggtgctgctgttgcttg |
41516461 |
T |
|
| Q |
201 |
tgcttgccaacatgttcatatgtgttttttgtgtctttgtttctgttagatattttatgtagta----gtaagataagaaatgaacaaagacaaatgtgc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41516460 |
tgcttgccaacatgttcatatgtgttttttgtgtctttgtttcttttagata-tttatgtagtaagatttaagataagaaatgaacaaagacaaatgtg- |
41516363 |
T |
|
| Q |
297 |
tttgtgtcaaaacttcacattcctatatttctatctc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41516362 |
tttgtgtcaaaacttcacattcctatatttctatctc |
41516326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University