View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3938_high_4 (Length: 337)
Name: NF3938_high_4
Description: NF3938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3938_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 27293287 - 27293085
Alignment:
| Q |
17 |
attttgcagattagcattaataggccggagaggaggaatgcttttcgacctcatacggttaaggagcttattcgtgctttcaatgatgctagagatgatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27293287 |
attttgcagattagcattaataggccggagaggaggaatgcttttcgacctcatacggttaaggagcttattcgtgctttcaatgatgctagagatgatc |
27293188 |
T |
 |
| Q |
117 |
cctctgttggtgtcatcattctcacgggaaaggtataccttttctgctactgccatttgttttattgttttgtgaacttgggcatgttgaggcaagaaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27293187 |
cctctgttggtgtcatcattctcacgggaaaggtataccttttctgctactgccatttgttttattgttttgtgaacttggtcatgttgaggtaagaaat |
27293088 |
T |
 |
| Q |
217 |
gga |
219 |
Q |
| |
|
||| |
|
|
| T |
27293087 |
gga |
27293085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 220 - 293
Target Start/End: Complemental strand, 27293059 - 27292986
Alignment:
| Q |
220 |
attatcatacaactagttcaccactaatttgttatgtgacttaagcattgctttaagtgattattagattgttt |
293 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27293059 |
attatcatacaactagttcactactaatttgttatgtgacttaagcattgctttaagtgattattagattgttt |
27292986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University