View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3938_low_11 (Length: 225)
Name: NF3938_low_11
Description: NF3938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3938_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 209
Target Start/End: Complemental strand, 32783119 - 32782922
Alignment:
| Q |
12 |
aaaggagaaaataaccatggtagttatacgtttatgatggaaatgtagactaggtggattatattagtaaaatttagagtattgttttcatgataactat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32783119 |
aaaggagaaaataaccatggtagttatacgtttatgatgaaaatgtagactaggtggattatatcagtaaaatttagagtattgttttcatgataactat |
32783020 |
T |
 |
| Q |
112 |
atcttgtccaaagaatcatttggctgattgaaaagaagttcaagagtttattggaattgctgtatatgcatcaacatgttcggacgaaatattattga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32783019 |
atcttgtccaaagaatcatttggctgattgaaaagaagttcaagagtttattggaattgctgtatatgcatcaacatgttcggacgaaatattattga |
32782922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University