View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3938_low_13 (Length: 214)
Name: NF3938_low_13
Description: NF3938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3938_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 142 - 198
Target Start/End: Original strand, 14129879 - 14129935
Alignment:
| Q |
142 |
taattatctcactgagttcctactaaaccataaagtggcctctaccatacttaattt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14129879 |
taattatctcactgagttcctactaaaccataaagtggcctctaccatacttaattt |
14129935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University