View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3938_low_3 (Length: 382)
Name: NF3938_low_3
Description: NF3938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3938_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 10 - 367
Target Start/End: Complemental strand, 6665090 - 6664733
Alignment:
| Q |
10 |
gacatcatcaggtagtggattgcgggaataggccccagtcggacagcctgactgcgtttgaagatcttaaggatgatgtggagggtgagtgccgcagtta |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6665090 |
gacatcattaggtagtggattgcgggaataggccccagtcggacagcctgactgcgtttgaagatcttaaggatgatgtggagggtgagtgccgcagtta |
6664991 |
T |
|
| Q |
110 |
tataagcggcgatggctgtgacgaggaatggccatgtgccgccccatgattggctcggactccatcggaaccaaactatggatggatggtctattagcca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6664990 |
tataagcggcgatggctgtgacgaggaatggccatgtgccgccccatgattgggtcggactccatcggaaccaaactatggatggatggtctattagcca |
6664891 |
T |
|
| Q |
210 |
atattttagggtctctttcagttggaatatcatttggaagactatttggtaggatgttcttaggaaatgagtaaggaannnnnnnnnnnnnnnnnnnnnn |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6664890 |
atattttagggtctctttcagttggaatatcatttggaagactatttggtaggatgttcttaggaaatgagtaaggaatgtgtgtttgtgtgtaagtgtg |
6664791 |
T |
|
| Q |
310 |
nacgttaatttgttaagtcttgaaagtggggtttgtcttgttttgaatggtaagaatt |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6664790 |
tacgttaatttgttaagtcttgaaagtggggtttgtcttgttttgattggtaagaatt |
6664733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University