View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3939_high_13 (Length: 302)

Name: NF3939_high_13
Description: NF3939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3939_high_13
NF3939_high_13
[»] chr2 (1 HSPs)
chr2 (27-290)||(40949347-40949611)
[»] chr1 (1 HSPs)
chr1 (242-290)||(34517702-34517750)
[»] chr3 (1 HSPs)
chr3 (245-290)||(18517704-18517749)
[»] chr5 (2 HSPs)
chr5 (242-290)||(2259404-2259452)
chr5 (242-278)||(5781099-5781135)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 27 - 290
Target Start/End: Complemental strand, 40949611 - 40949347
Alignment:
27 ttttttaaatcagttaattgattaaccggtctaaaaagtcctgcatcatgtttgtaataattagtctccacatctatacaaacaagaggtacaactttta 126  Q
    ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
40949611 tttttaaaatcagttaactgattaaccggtctaaaaagtcctgcatcatgtttgtaataatgagtctccacatctatacaaacaagaggtacaactttta 40949512  T
127 agatcgcttaatcatttaaccgggttaaagagtgaattgtttgttacc-nnnnnnnnngagtgaattgttcttaacaaccatttaatagtgatgcttgtc 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||| |||| ||||||||||||||||    
40949511 agatcgcttaatcatttaaccgggttaaagagtgaattgtttgttaccaaaaaaaaaagagtgaattgttcttaacaatcattcaatagtgatgcttgtc 40949412  T
226 ctttatggggtgaattgtttctcgggatgccaaccttgttggggtgtcgatgtgtcctcttgatg 290  Q
    |||  ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||    
40949411 cttgttggggtgaattgtttctcggggtgccaaccttgttggggtgtcgatgtgttctcttgatg 40949347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 242 - 290
Target Start/End: Original strand, 34517702 - 34517750
Alignment:
242 gtttctcgggatgccaaccttgttggggtgtcgatgtgtcctcttgatg 290  Q
    ||||||||||||||||||||| ||||| ||||||||| || ||||||||    
34517702 gtttctcgggatgccaaccttattgggatgtcgatgtttcttcttgatg 34517750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 290
Target Start/End: Original strand, 18517704 - 18517749
Alignment:
245 tctcgggatgccaaccttgttggggtgtcgatgtgtcctcttgatg 290  Q
    ||||||||||||||||| |||||| |||||||||  ||||||||||    
18517704 tctcgggatgccaacctagttgggatgtcgatgttgcctcttgatg 18517749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 290
Target Start/End: Complemental strand, 2259452 - 2259404
Alignment:
242 gtttctcgggatgccaaccttgttggggtgtcgatgtgtcctcttgatg 290  Q
    ||||| |||||||||||||| |||||| ||||| ||| |||||||||||    
2259452 gtttcccgggatgccaacctagttgggatgtcggtgtttcctcttgatg 2259404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 278
Target Start/End: Complemental strand, 5781135 - 5781099
Alignment:
242 gtttctcgggatgccaaccttgttggggtgtcgatgt 278  Q
    |||||||||||||||||||| |||||| |||||||||    
5781135 gtttctcgggatgccaacctagttgggatgtcgatgt 5781099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University