View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3939_high_19 (Length: 244)
Name: NF3939_high_19
Description: NF3939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3939_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 53186148 - 53185927
Alignment:
| Q |
19 |
cgtacacggtccggtgaacgtgtacgggatctcttgctgcgtgctctgtcacgatcacggttgcgatcacgatcgacgtcacggtcgcggtcgtctttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53186148 |
cgtacacggtccggtgaacgtgtacgggatctcttgctgcgtgctctgtcgcgatcacggttgcgatcacgatcgacgtcacggtcgcggtcgtctttgt |
53186049 |
T |
|
| Q |
119 |
ctcgtcttcgatctctttctctgtcgcggtggcggtcacggtcgctcattgtggaagatagggtttagagttcatgattcaatttggtgcaaaaccctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53186048 |
ctcgtcttcgatctctttctctgtcgcggtggcggtcacggtcgctcattgtggaagatagggtttagagttcatgattcaatttggtgcaaaaccctgt |
53185949 |
T |
|
| Q |
219 |
aatatacatctttgctcccttt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53185948 |
aatatacatctttgctcccttt |
53185927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University