View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3939_low_22 (Length: 237)
Name: NF3939_low_22
Description: NF3939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3939_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 42439236 - 42439453
Alignment:
| Q |
1 |
aaaccttaactacagtgacacacagtgcaagaatcaagatagttgtatttaaataatatttcacaaccgtttatgtaaagtgtcgactggcattcagaca |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42439236 |
aaactttaactacagtgacacacagtgcaagaatcaagatagttgtatttaaataatatttcacaaccgtttatgtaaagtgtcgactggcattcagaca |
42439335 |
T |
|
| Q |
101 |
aaatttgatttatttaggagtgagagtggttcatggtgttggatcaagaaagcatgtctcacactacattctctnnnnnnnntctcacattagacataag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42439336 |
aaatttgatttatttaggagtgagagtggttaatggtgttggatcaagaaagcatgtctcacactacattctct-aaaaaaatctcacattagacataac |
42439434 |
T |
|
| Q |
201 |
attaaatattgagtaacat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42439435 |
attaaatattgagtaacat |
42439453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University