View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3939_low_24 (Length: 235)
Name: NF3939_low_24
Description: NF3939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3939_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 8765656 - 8765869
Alignment:
| Q |
17 |
aagtctgaggcggttgttgacccggttgatctgatttggcatagttgggcaccctttaaagttaatcctgcaagttatcctcgatagggccccaactcgt |
116 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8765656 |
aagtttgaggcggttgttgacccgcttgatctgatttggcatagttgggcaccctctaaagttcatcctgcaagttatcctcgatagggccccaactcgt |
8765755 |
T |
 |
| Q |
117 |
caaaatctctttaagcgcagggtgatctctaatcaagtaaactttatgtgccctattcgtgaggagaatgtggaatcagtggatcatctgtttgtcactt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8765756 |
caaaatctctttaagcgcagggtgatctctaatcaagtaaactttatgtgccctattcgtgaggagaatgtggaatcagtggatcatctttttgtcactt |
8765855 |
T |
 |
| Q |
217 |
gtaggatgatgtcc |
230 |
Q |
| |
|
||||| || ||||| |
|
|
| T |
8765856 |
gtagggtggtgtcc |
8765869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University