View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3939_low_26 (Length: 213)
Name: NF3939_low_26
Description: NF3939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3939_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 41245312 - 41245128
Alignment:
| Q |
17 |
agtctgaatcttggtggaataagtagcaccagctttccaacctgcaggtattgcgaaccttgactccacccaattgaccccaacattgctactaacttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41245312 |
agtctgaatcttggtggaataagtagcaccagctttccaacctgcaggtattgcgaaccttgactccacccaattgaccccaacattgctactaacttga |
41245213 |
T |
 |
| Q |
117 |
aacctcaatctgatttcacctttgggtgtgttagcatagtcaaatactgccccataagaccgacgcatgtactcccatctgtgct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41245212 |
aacctcaatctgatttcacctttgggtgggttagcatagtcaaatactgccccataagaccgacgcatgtactcccatttgtgct |
41245128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 50 - 136
Target Start/End: Complemental strand, 41237885 - 41237795
Alignment:
| Q |
50 |
tttccaacctgcagg---tattgcgaaccttgactccacccaattgaccccaacattgctactaac-ttgaaacctcaatctgatttcacc |
136 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
41237885 |
tttccaacctgcaggaggtactgcgaaccttgactccacccaattgaccccaaaattgctactcactttggaacctcaatctgatttcacc |
41237795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University