View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3940_high_3 (Length: 290)
Name: NF3940_high_3
Description: NF3940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3940_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 7 - 148
Target Start/End: Complemental strand, 13908367 - 13908226
Alignment:
| Q |
7 |
acatcatcaatttaacatggtataaggacatcatataaaactacaccaaaaacaagagttaatttgattagagagagaattattgttagaccgaatgaga |
106 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13908367 |
acatcattaatttaacatggtataatgacatcatataaaactacaccaaaagcaatagttaatttgattagagagagaattattgttaaaccgaatgaga |
13908268 |
T |
 |
| Q |
107 |
accgtatcaaaataacttttccgtttacaaaacaatttaaat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13908267 |
accgtatcaaaataacttttccgtttacaaaacaatttaaat |
13908226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University