View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3940_high_6 (Length: 227)
Name: NF3940_high_6
Description: NF3940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3940_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43927139 - 43927376
Alignment:
| Q |
1 |
tcatcagaaacaaccccaaattcaccatgccccttgacaaaatgtgaacctgcatgcacattg-----------ttatatctgagcgtgacaggcaaact |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43927139 |
tcatcagaaacaaccccaaattcaccatgccccttgacaaaatgtgaacctgcatgcacattgcattcactttgttatatctgagcgtgacaggcaaact |
43927238 |
T |
 |
| Q |
90 |
aattaatagcaatagtttaaccaaagttacataatcaatcacaatcatatactgattttcttcacatctatgtattgtataacaaataacaaataaacgg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43927239 |
aattaatagcaatagtttaaccaaagttacataatcaatcacaatcatatactgattttcttcacatctatgtattgtataacaaagaacaaataaacgg |
43927338 |
T |
 |
| Q |
190 |
ctaaatcaaatccctcaaacatgacatgttcaatcata |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43927339 |
ctaaatcaaatccctcaaacatgacatgttcaatcata |
43927376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University