View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3941_high_3 (Length: 536)

Name: NF3941_high_3
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3941_high_3
NF3941_high_3
[»] chr6 (2 HSPs)
chr6 (390-515)||(19606911-19607033)
chr6 (141-232)||(17708402-17708493)
[»] chr3 (1 HSPs)
chr3 (58-332)||(19266476-19266748)
[»] chr1 (1 HSPs)
chr1 (141-185)||(36187073-36187117)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 3e-49; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 390 - 515
Target Start/End: Original strand, 19606911 - 19607033
Alignment:
390 acagtaatgaaggaggagatttttaggactggtgagggagaaaagattgccgagagaatgggagaagaaggtgagggagaaaaaagagtgagtgggggaa 489  Q
    |||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||   |||||||||||||||||||||||||||||||    
19606911 acagtaatgaaggaagatatttttaggactggtgagggagaaaagattcccgagagaatgggagaa---ggtgagggagaaaaaagagtgagtgggggaa 19607007  T
490 acaagggagcaggagggggcaggtct 515  Q
    ||||||||||||||||||||||||||    
19607008 acaagggagcaggagggggcaggtct 19607033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 232
Target Start/End: Original strand, 17708402 - 17708493
Alignment:
141 tttgaggtatgtggaattatggataatttatttttgtctaggaagcgaaacaagcagggacatgcttatggtttcgtaagatatttgaatgt 232  Q
    |||||||| |||||||||||||| |||||||| |||||  ||||| | || | ||||||  ||| ||||||||| || |||||| |||||||    
17708402 tttgaggtgtgtggaattatggacaatttattcttgtcacggaagaggaataggcagggttatgtttatggttttgtcagatatgtgaatgt 17708493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 80; Significance: 3e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 58 - 332
Target Start/End: Original strand, 19266476 - 19266748
Alignment:
58 tggggtcaaacttgaaacagtacgtaactttctatttcactaatgtgccggacctgttaccttatcactgcgccagggaagggtttgaggtatgtggaat 157  Q
    |||||||||||| ||||| ||| |||||||| || |||||||||||||||||| ||||||  |||||||  || | |||||| ||||||||||| |||||    
19266476 tggggtcaaactggaaaccgtatgtaactttttacttcactaatgtgccggacatgttactgtatcacttagcaaaggaaggttttgaggtatgcggaat 19266575  T
158 tatggataatttatttttgtctaggaagcgaaacaagcagggacatgcttatggtttcgtaagatatttgaatgttaaagacgtagacaaattgctaaag 257  Q
    | |||| |||||||||||||| ||||| ||||||||||  || ||  |||||||||| |  || |||| ||||||||  || ||||||||||| || |||    
19266576 tctggaaaatttatttttgtccaggaaacgaaacaagc--ggtcacacttatggttttgccaggtattcgaatgttagggatgtagacaaatttcttaag 19266673  T
258 gcaatgaataatgttgctttcgggcagtatcgtgtttaggctaagcttgctcgtttcgatagaaagtttgatggt 332  Q
    ||  ||||||| ||| ||||||| |||| |||||| | ||| || |||| ||| || |||||||| | |||||||    
19266674 gctgtgaataacgtttctttcggtcagtttcgtgtgtgggcaaaacttgatcgctttgatagaaattctgatggt 19266748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 36187073 - 36187117
Alignment:
141 tttgaggtatgtggaattatggataatttatttttgtctaggaag 185  Q
    |||||||| |||||||||||||| |||||||||||||| ||||||    
36187073 tttgaggtgtgtggaattatggacaatttatttttgtcaaggaag 36187117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University