View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_high_31 (Length: 303)
Name: NF3941_high_31
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 189 - 285
Target Start/End: Complemental strand, 34571013 - 34570917
Alignment:
| Q |
189 |
ttatggaaattgtcgtgggttgtgtacaatttcatcaccaccttcttataaggaggaaaacaaagaactatcaagattgtataaaataccaccataa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34571013 |
ttatggaaattgtcgtgggttgtgtacaatttcatcaccaccttcttataaggaggaaaacaaataactatcaaaattgtataaaataccaccataa |
34570917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 66
Target Start/End: Complemental strand, 34561799 - 34561758
Alignment:
| Q |
25 |
gtggaatatgattgaccgttaataatatttggaaagctgttt |
66 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
34561799 |
gtggaatatgattgaccattaataatatttggaaagttgttt |
34561758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University