View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_high_7 (Length: 467)
Name: NF3941_high_7
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 171 - 234
Target Start/End: Original strand, 12574404 - 12574467
Alignment:
| Q |
171 |
atgtatagagatttaaattgttgatattccatctcgaatcttgctagatatgcttaactttgtt |
234 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12574404 |
atgtatagagatttaaattgttcattttccatctcgaatcttgctagatatgcttaaatttgtt |
12574467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 174 - 234
Target Start/End: Original strand, 500984 - 501044
Alignment:
| Q |
174 |
tatagagatttaaattgttgatattccatctcgaatcttgctagatatgcttaactttgtt |
234 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
500984 |
tatagagatttaaatcgttgattttccatctcgaatattgctagatatgcttaactttgtt |
501044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 424 - 460
Target Start/End: Complemental strand, 500300 - 500264
Alignment:
| Q |
424 |
caaaccctattgttttttgaacaagcaccaaacccta |
460 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
500300 |
caaaccctattcttttttaaacaagcaccaaacccta |
500264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 42
Target Start/End: Original strand, 29458360 - 29458392
Alignment:
| Q |
10 |
taatttgagaaaatggaagagatcgaatgtaat |
42 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
29458360 |
taatttgagaaaatggaagagattgaatgtaat |
29458392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University