View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_12 (Length: 426)
Name: NF3941_low_12
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 16 - 176
Target Start/End: Original strand, 44858407 - 44858567
Alignment:
| Q |
16 |
atccccaaatctcttcgttctctcaaaacccaaacaccatggacaccgatggattatccctaatctgcagcggtctcggcgccattgaagaagatgatga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858407 |
atccccaaatctcttcgttctctcaaaacccaaacaccatggacaccgatggattatccctaatctgcagcggtctcggcgccattgaagaagatgatga |
44858506 |
T |
|
| Q |
116 |
aggcaaacgaatcggttattccaagggtgaatactgtctcggtatgaatgaatttgtttca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858507 |
aggcaaacgaatcggttattccaagggtgaatactgtctcggtatgaatgaatttgtttca |
44858567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 293 - 408
Target Start/End: Original strand, 44858684 - 44858799
Alignment:
| Q |
293 |
agacgtgatgatccgcaatcccgcgatgtgttcaagcaagtgtgtaaatggaacatcgtttcaaaggatttggtaccgattatagagcattaccaccaag |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858684 |
agacgtgatgatccgcaatcccgcgatgtgttcaagctagtgtgtaaatggaacatcgtttcaaaggatttggtaccgattatagagcattaccaccaag |
44858783 |
T |
|
| Q |
393 |
atcgtagcatgcttct |
408 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44858784 |
atcgtagcatgcttct |
44858799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University