View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3941_low_32 (Length: 303)

Name: NF3941_low_32
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3941_low_32
NF3941_low_32
[»] chr2 (2 HSPs)
chr2 (189-285)||(34570917-34571013)
chr2 (25-66)||(34561758-34561799)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 189 - 285
Target Start/End: Complemental strand, 34571013 - 34570917
Alignment:
189 ttatggaaattgtcgtgggttgtgtacaatttcatcaccaccttcttataaggaggaaaacaaagaactatcaagattgtataaaataccaccataa 285  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||    
34571013 ttatggaaattgtcgtgggttgtgtacaatttcatcaccaccttcttataaggaggaaaacaaataactatcaaaattgtataaaataccaccataa 34570917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 66
Target Start/End: Complemental strand, 34561799 - 34561758
Alignment:
25 gtggaatatgattgaccgttaataatatttggaaagctgttt 66  Q
    ||||||||||||||||| |||||||||||||||||| |||||    
34561799 gtggaatatgattgaccattaataatatttggaaagttgttt 34561758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University