View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_37 (Length: 286)
Name: NF3941_low_37
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 126 - 275
Target Start/End: Complemental strand, 50785537 - 50785389
Alignment:
| Q |
126 |
ataagtatttctatcattggttgtgtcacactacgctggtaatgcaaatacagttttgtctaagaaaatatcaatccgcaccctcctttgtccctatgga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
50785537 |
ataagtatttctatcattggttgtgtcacactacgctggtaatgcaaatacggttttgtctaagaaaatatcaatccgca-ccttctttgtccctatgga |
50785439 |
T |
 |
| Q |
226 |
ttcagttttgctacaaaaagtcccaaccttctatttgttccgttctctct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50785438 |
ttcagttttgctacaaaaagtcccaaccttctatttgttccgttctctct |
50785389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 17 - 124
Target Start/End: Complemental strand, 50785764 - 50785657
Alignment:
| Q |
17 |
aaaaacttatgtgatttatgggttattgatgtgtataatctcaaattagcaacaaatgttttatgtataacaacgcagagaacatagaaaaatcattttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50785764 |
aaaaacttatgtgatttatgggttattgatgtgtataatatcaaattagcaacaaatgttttatgtataacaacgcagagaacatagaaaaatcattttg |
50785665 |
T |
 |
| Q |
117 |
aactatga |
124 |
Q |
| |
|
|||||||| |
|
|
| T |
50785664 |
aactatga |
50785657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 199 - 274
Target Start/End: Original strand, 50786105 - 50786180
Alignment:
| Q |
199 |
atccgcaccctcctttgtccctatggattcagttttgctacaaaaagtcccaaccttctatttgttccgttctctc |
274 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50786105 |
atccgcaccctcatttgtccgtatggattcacttttgccacaaaaagtcccaaccttctatttgttccgttctctc |
50786180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University