View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_38 (Length: 285)
Name: NF3941_low_38
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 50785411 - 50785174
Alignment:
| Q |
1 |
cttctatttgttccgttctctcttttgcttatcaata---catttgaatgggtcattgaatcaatgtcggtattacacatatcaatctataattgtatta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50785411 |
cttctatttgttccgttctctcttttgcttatcaataatacatttgaatgggtcattgaatcaatgtcggtattacacatatcaatctacaattgtatta |
50785312 |
T |
 |
| Q |
98 |
gattgatagtgtgcatccttttatgatcataattaagacatcacttaaaaggacatcctcttaaaataaatgcatccatcaaccatcaagcaagtaaacg |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50785311 |
gattgatagtgtgcatcattttatgatcataattaagacatcacttaaaaggacatcctcttaaaataaatgcatccatcaaccatcaagcaagtaaacg |
50785212 |
T |
 |
| Q |
198 |
ataagttaaatgaatacgtacaatggatttagttcagt |
235 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50785211 |
ataagttaaatgaatacgtacaattgatttagttcagt |
50785174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University