View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_39 (Length: 282)
Name: NF3941_low_39
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 100 - 266
Target Start/End: Original strand, 1790713 - 1790877
Alignment:
| Q |
100 |
gccccactaaaaaatgagggtaagaccaaaattatttcaaacttctatatgtatttatatatatcaccgacagttcatattaaaaacatgtttgatattc |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1790713 |
gccccactaaaaaatgagggtaagatcaaaattatttcaaacttctatatgtatttata--tatcaccgacagttcatattaaaaacatgtttgatattc |
1790810 |
T |
|
| Q |
200 |
aacatgtgtcaatgtcttatcttcgcacaacactaatatatatgattgcatttattaatttcatttt |
266 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||||||||| |||||||||||| |||||| |
|
|
| T |
1790811 |
aacatgtgtcaatgtcttatctttgcacaacagtaacatatatgattacatttattaattccatttt |
1790877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 15 - 101
Target Start/End: Original strand, 1790595 - 1790681
Alignment:
| Q |
15 |
agatgtacccaaaatctctgaattgtttttatatatgaatacataaaaaccatgaacatagtaggagttttatgcgatcatcattgc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1790595 |
agatgtacccaaaatctctgaattgtttttatatatgaatacataaaaaccatgagcatagtaggagttttatgcgatcatcattgc |
1790681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University