View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_4 (Length: 536)
Name: NF3941_low_4
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 3e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 390 - 515
Target Start/End: Original strand, 19606911 - 19607033
Alignment:
| Q |
390 |
acagtaatgaaggaggagatttttaggactggtgagggagaaaagattgccgagagaatgggagaagaaggtgagggagaaaaaagagtgagtgggggaa |
489 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19606911 |
acagtaatgaaggaagatatttttaggactggtgagggagaaaagattcccgagagaatgggagaa---ggtgagggagaaaaaagagtgagtgggggaa |
19607007 |
T |
 |
| Q |
490 |
acaagggagcaggagggggcaggtct |
515 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
19607008 |
acaagggagcaggagggggcaggtct |
19607033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 232
Target Start/End: Original strand, 17708402 - 17708493
Alignment:
| Q |
141 |
tttgaggtatgtggaattatggataatttatttttgtctaggaagcgaaacaagcagggacatgcttatggtttcgtaagatatttgaatgt |
232 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||| ||||| | || | |||||| ||| ||||||||| || |||||| ||||||| |
|
|
| T |
17708402 |
tttgaggtgtgtggaattatggacaatttattcttgtcacggaagaggaataggcagggttatgtttatggttttgtcagatatgtgaatgt |
17708493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 80; Significance: 3e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 58 - 332
Target Start/End: Original strand, 19266476 - 19266748
Alignment:
| Q |
58 |
tggggtcaaacttgaaacagtacgtaactttctatttcactaatgtgccggacctgttaccttatcactgcgccagggaagggtttgaggtatgtggaat |
157 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||| || |||||||||||||||||| |||||| ||||||| || | |||||| ||||||||||| ||||| |
|
|
| T |
19266476 |
tggggtcaaactggaaaccgtatgtaactttttacttcactaatgtgccggacatgttactgtatcacttagcaaaggaaggttttgaggtatgcggaat |
19266575 |
T |
 |
| Q |
158 |
tatggataatttatttttgtctaggaagcgaaacaagcagggacatgcttatggtttcgtaagatatttgaatgttaaagacgtagacaaattgctaaag |
257 |
Q |
| |
|
| |||| |||||||||||||| ||||| |||||||||| || || |||||||||| | || |||| |||||||| || ||||||||||| || ||| |
|
|
| T |
19266576 |
tctggaaaatttatttttgtccaggaaacgaaacaagc--ggtcacacttatggttttgccaggtattcgaatgttagggatgtagacaaatttcttaag |
19266673 |
T |
 |
| Q |
258 |
gcaatgaataatgttgctttcgggcagtatcgtgtttaggctaagcttgctcgtttcgatagaaagtttgatggt |
332 |
Q |
| |
|
|| ||||||| ||| ||||||| |||| |||||| | ||| || |||| ||| || |||||||| | ||||||| |
|
|
| T |
19266674 |
gctgtgaataacgtttctttcggtcagtttcgtgtgtgggcaaaacttgatcgctttgatagaaattctgatggt |
19266748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 36187073 - 36187117
Alignment:
| Q |
141 |
tttgaggtatgtggaattatggataatttatttttgtctaggaag |
185 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
36187073 |
tttgaggtgtgtggaattatggacaatttatttttgtcaaggaag |
36187117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University