View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_42 (Length: 265)
Name: NF3941_low_42
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_42 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 30147842 - 30147607
Alignment:
| Q |
11 |
cagagatgagtgcaacagggggattagggtgggtgttaaaccagtggataattggagtttggagattggagagggcgttaatgaaaggatagtttccagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30147842 |
cagagatgagtgcaacagggggattagggtgggtgttaaaccagtggataattggactttggagattggaaagggcgttaatgaaaggatagtttccagt |
30147743 |
T |
|
| Q |
111 |
gttaccgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaaagggagaatgagtgtttggatggtgtttgggtgagttgataag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30147742 |
gttaccgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaaagggagaatgagtgtttggatggtgtttgggtgagttgataag |
30147643 |
T |
|
| Q |
211 |
agagggtttagtatagggaggtttttaggggtgatg |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30147642 |
agagggtttagtatagggagatttttaggggtgatg |
30147607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 141771 - 141999
Alignment:
| Q |
16 |
atgagtgcaacagggggattagggtgggtgttaaaccagtggataattggagtttggagattggagagggcgttaatgaaaggatagtttccagtgttac |
115 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||| ||||| ||||| |||| |||||||| || ||||||||||||||||||||||| | ||| | |
|
|
| T |
141771 |
atgagagcaacagggggattatggtggatgttaaaccactggattattgggttttgaagattggaaagtgcgttaatgaaaggatagtttccggggtttc |
141870 |
T |
|
| Q |
116 |
cgacatgacggatattttctgcatcttgaggtatttttgggtgtgaagggaaagggagaatgagtgtttggatggtgtttgggtgagttgataagagagg |
215 |
Q |
| |
|
||| | ||||| |||||| ||||| |||||||| |||||||||||||| |||| || ||||||| ||| ||||||||||| ||||| || ||||| |
|
|
| T |
141871 |
cgatttcacggagattttcaacatctgagggtattttggggtgtgaagggaatgggaagattagtgttttgattgtgtttgggtgtgttgacaaaagagg |
141970 |
T |
|
| Q |
216 |
gtttagtatagggaggtttttaggggtga |
244 |
Q |
| |
|
| ||| || |||||||||||||| |||| |
|
|
| T |
141971 |
ggttaagatggggaggtttttaggagtga |
141999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University