View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_45 (Length: 255)
Name: NF3941_low_45
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_45 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0024 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 14144 - 13907
Alignment:
| Q |
18 |
acaagctggactgtgaatgtcatgaaggccaagcttggatatgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcg |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14144 |
acaagctggactgtgaatgtcatcaaggccaagcttggatatgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgca |
14045 |
T |
|
| Q |
118 |
gcagaaggtatgggaaatagtcgcagcaggccattttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14044 |
gcagaaggtatgggaaatagtcgcagcagaccattttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactgg |
13945 |
T |
|
| Q |
218 |
ggttatgtgcgaggtagattgctgatttattgtcgcag |
255 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13944 |
ggttatgtgcgaggtagatggctgatttattgtcgcag |
13907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 43010780 - 43010867
Alignment:
| Q |
163 |
tctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgatttattgtc |
251 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||||||||||| || ||| |||||| || |||| ||| |||||| |||||| |
|
|
| T |
43010780 |
tctctgatgatgtgacaatctatttcaacgtgtttaatacgttcatggtaa-tggtgttatgggcaaggtcgatgtctgattcattgtc |
43010867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 243
Target Start/End: Complemental strand, 38825738 - 38825646
Alignment:
| Q |
151 |
ttttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgat |
243 |
Q |
| |
|
||||||||||| |||||||| | || |||||||| ||||| ||||| ||||| ||||| ||| | |||||||| || || || ||||||||| |
|
|
| T |
38825738 |
ttttgaatcttttctctaattacatggcaatctatctcaatatgttttgtacgctcatgaaaagtagggttatgagcaagataaattgctgat |
38825646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 243
Target Start/End: Complemental strand, 46604668 - 46604576
Alignment:
| Q |
151 |
ttttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgat |
243 |
Q |
| |
|
||||||||||| |||||||| | || |||||||| ||||| ||||| ||||| ||||| ||| | |||||||| || || || ||||||||| |
|
|
| T |
46604668 |
ttttgaatcttttctctaattacatggcaatctatctcaatatgttttgtacgctcatgaaaagtagggttatgagcaagataaattgctgat |
46604576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 243
Target Start/End: Original strand, 17881586 - 17881678
Alignment:
| Q |
151 |
ttttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgat |
243 |
Q |
| |
|
||||||||||| |||||||| | || |||||||| ||||| ||||| ||||| ||||| ||| | |||||||| || || || ||||||||| |
|
|
| T |
17881586 |
ttttgaatcttttctctaattacatggcaatctatctcaatatgttttgtacgctcatgaaaagtagggttatgagcaagataaattgctgat |
17881678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University