View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_54 (Length: 232)
Name: NF3941_low_54
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 11592607 - 11592414
Alignment:
| Q |
19 |
aatcattgatgagtttgttgaatttattgggattttcaagtggttatggaatgaatgtttggataacatttgtttctagttatgttttgtctagggttat |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11592607 |
aatcattgatgagtttgttgaatttgttgggattttcaagtggttatggaatgaatgtttggatcacatttgtttctagttatgttttgtctagggttat |
11592508 |
T |
|
| Q |
119 |
gccaagacaacaatttgctgtggtccagagtaagatttatcctgtttattttagggctatgggttattgtttattggttgctttgttgggtcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11592507 |
gccaagacaacaatttgctgtggtccagagtaagatttatcctgtttattttagggctatgggttattgtttattggttgctttgttgggtcat |
11592414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 11645512 - 11645705
Alignment:
| Q |
19 |
aatcattgatgagtttgttgaatttattgggattttcaagtggttatggaatgaatgtttggataacatttgtttctagttatgttttgtctagggttat |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11645512 |
aatcattgatgagtttgttgaatttgttgggattttcaagtggttatggaatgaatgtttggatcacatttgtttctagttatgttttgtctagggttat |
11645611 |
T |
|
| Q |
119 |
gccaagacaacaatttgctgtggtccagagtaagatttatcctgtttattttagggctatgggttattgtttattggttgctttgttgggtcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11645612 |
gccaagacaacaatttgctgtggtccagagtaagatttatcctgtttattttagggctatgggttattgtttattggttgctttgttgggtcat |
11645705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University