View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3941_low_55 (Length: 232)
Name: NF3941_low_55
Description: NF3941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3941_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 28441682 - 28441489
Alignment:
| Q |
19 |
cattcaccatggaagaagaaattccggcggaagacagattcagtgcattacccgatcaagttctaacacacattacatcttttcttccaatggaagatat |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28441682 |
cattcaccatggaagaaggaattccggcggaagacagattcagtgcattacccgatcaagttctaacacacattacatcttttcttccaatggaagatat |
28441583 |
T |
|
| Q |
119 |
ttacaagatctcaaatctttcctttcgtttgtcctacttccccattcacaagttcacattcacgatcggttgtcattaccttacaaaggaggac |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28441582 |
tttcaagatctcaaatctttcctttcgtttgtccaatttccccattcacaagttcacattcacgatcggttctcattaccttacaaaggaggac |
28441489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University